DNA Keychain 3d models

By matching complementary DNA or RNA strands at the tops, kids can learn about the structure of DNA and base pairing without prior instruction. The kit also includes tRNA models that demonstrate transcription and translation processes. By splitting...

DNA-B-form atomic structure, surface;Generated in pymol, mesh-simplified in meshlab to reduce file size;DNA sequence: TGCTAAGGATCTGGCTGCATGCTATGTTGATACACCTACACTGCTCGAAG(randomy generated using https://faculty.ucr.edu/~mmaduro/random.htm)PDB file...

The DNA ring is now primed for printing after being thoroughly vetted by a team of experts across multiple 3D printers to achieve flawless results. ...The custom-made ring comes in size 14, requiring zero edits or modifications.

This molecular model demonstrates a lambda bacteriophage Cro protein and the DNA region to which it binds, keeping the phage dormant. ...Stress triggers degradation of this protein and the re-expression of the phage.

This is an upgrade part intended for use with Combiner Wars Devastator combined with DNA Design's DK-01 upgrade kit. ...If the right arm, Scavenger, starts to droop over time, this stabilizer will help lock it in place.

Files: DNA_Helix_Pencil_Holder_Remixed_two_in_one01.stl Exceeds Printer Capacity at 215mm Height and Requires Larger Equipment. DNA_Helix_Pencil_Holder_Remixed_two_in_one01_68percent_scaled.stl Has Been Scaled Down to Below 150mm in Height. Further...

... incorporated bone texture materials, while an HDRi map (included) can be used to enhance reflections and a background image (also included) can be utilized. Each DNA strand has 558,417 polygons that you can adjust using the meshsmooth function.

Humans have been using DNA to create advanced mods since 2005, with the release of the original "DNA" mod pack by Umbra Studios. This groundbreaking mod allowed users to customize their game experience like never before, giving them complete control...

Human: **See video to view the kit in action!** This set lets students learn about DNA and RNA by playing with blocks and modeling processes involving DNA, as described below Each nucleotide block shows its base's letter symbol and shape (either...

Chromosome X and Y, DNA Strands Molecule Concept - Medically Accurate Human Anatomy High-Quality 3D Model. Hi-Poly 3D Model of Human DNA Strand and Chromosome X and Y Was Created Using Advanced Bone Texture Materials. Includes HDRi Map for Realistic...

This learning set is designed to empower students to grasp DNA and RNA by engaging with the blocks, while also serving as a manipulative tool to model processes that involve DNA (described below). The set is engineered to be accessible for both...

In terms of ‘clean’ airflow paths into the filter - whilst it's an improvement on the original equipment - I thought I'd go one step further and create an inlet bell that simply sits atop the DNA plate to create better airflow paths into the filter....

Remixed from an original design crafted by chemteacher628 at Thingiverse (https://www.thingiverse.com/thing:1261572), this upgraded DNA/RNA building set enhances joint connection, fitting, and 3D printing ease for students. By playing with the toy...

Great for discussing the structure of nucleotides and DNA. I made this to use it for teaching Biochemistry and Structural Biology. Print Settings Printer Brand: Creality Printer: Ender 5Rafts: Doesn't Matter Supports: YesResolution: 0.2 Infill: ...

Reimagined from the original blueprint by chemteacher628 (https://www.thingiverse.com/thing:1261572), this DNA/RNA building set gets a high-tech makeover with enhanced design features that make it easier to assemble and print in 3D. Students can now...

Low Poly DNA Symbol 3D Model DNA Symbol The file is created in Blender 2.8 and can be opened with compatible software. Archive includes files: .blend, .fbx, .obj, .ply. Rendered with Blender 2.8 Eevee. Polygons: 294. Vertices: 324. To open the file,...

This is a high quality three dimensional model of the DNA (Deoxyribonucleic acid). This is a high quality geometric model with a detailed surface texture applied. this texture is pre applied to the geometry so no need for an image . ...there are:...

This is a DNA pen holder for 11 pens with a diameter of max. ...9 mm (0,354'' for our american friends :)) The stand is a model of a plant cell to make this a perfect gift for people that like biology Made with help of this nice work...

A stunning torus-shaped sculpture crafted by precisely engineered DNA molecules comes into view. It's an attractive addition to any room, much like a festive science-themed holiday wreath. Currently measuring five inches in diameter, it's undeniable...

The design for a compact DNA 75-200 dual battery box mod has been conceptualized, featuring four millimeter diameter strong magnets. This device would allow for the convenient storage of two 20700 batteries, which can be easily tested and mounted...

Tree modelled after a DNA helix structure, saved as fbx files for seamless integration. Perfectly suited for rendering, with accompanying render files included. Each render was completed using Blender's robust 2.91 Cycles and Eevee engines. ...The zip...

DNA is the most authentic GANDIABLASCO collection, it includes in its design the warmth and durability of teak wood.‎ The warmth and naturalness of teak wood contrast with the coldness of the aluminium that frames the furniture, GANDIABLASCO’s fetish...

Modeling the iconic B-DNA dodecamer from 1BNA.pdb, this classical cartoon representation offers an ideal framework for dissecting the intricacies of the helix. ...Crafted with pedagogy in mind, this visual tool is specifically designed to facilitate...

DNA animation takes center stage with dynamic particles in motion. Pre-applied materials ensure a sleek appearance, sans textures for maximum flexibility. ...This versatile asset can be utilized as a standalone double helix model, easily cloned to meet...

**See video to view the kit in action! This set is designed to allow students to learn about DNA and RNA through playing with the blocks as well as to serve as a manipulative to model processes that involve DNA (described below) Each nucleotide block...

Remixed from the original design with improved features by chemteacher628, this DNA/RNA building set offers students a better way to learn about DNA and RNA through interactive play with toy blocks. Designed by Ana Wallis, a PhD student from the...

Outdoor sofa DNA TEAK by GANDIABLASCO Designers José Antonio Gandía-Blasco Year of production 2018 Made from anodized or thermo-lacquered aluminum profiles and teak wood. The DNA collection is the most authentic GANDIABLASCO design, now featuring...

Remixed from the original design by chemteacher628 with improved features for better joint connection and fitting, this DNA/RNA building set makes learning about DNA and RNA a fun experience through interactive play with toy blocks. This remix was...

To use the 3D-printed DNA gel electrophoresis box, attach banana jacks for power supply connection and insert platinum (coated) wires into the buffer. This DIY Bio tool is compatible with Ultimaker due to its 20 cm dimensions. Purchase parts on...

Just imagine being able to harness this limitless potential by turning our DNA into a storage medium - the ultimate cutting-edge innovation that defies convention! ...This concept has sparked visions of creating a device capable of holding 1000TB, and...