dna rna model
2056000 3d models found related to dna rna model.
cults3d
I re-modeled the DNA HElix Pencil Holder so you can have different configurations
grabcad
An inventively crafted USB stick modeled after the structure of DNA molecules.
grabcad
Medium sized desktop DNA sculpture that is 4" diameter x 6.5" tall. ...This is an update of my poorly done 2015 SketchUp model: https://3dwarehouse.sketchup.com/model/u724d5c6e-22ab-405a-b067-e375a49997b4/DNA-SculptureModel units are inch.
prusaprinters
A DNA model where the letters representing the bases of DNA contribute to the pairing. This is a continuation of my attempts to create something to help me remember which bases are which via 3D representations. ... Category: Interactive Art
thingiverse
A tweaked mirror replica of the Hello18 model is utilized to ensure that the DNA strand is printed with a standard right-twisted spiral structure - much like conventional double-stranded DNA, but not in the manner of zDNA.
cults3d
This is a simple mirrored remix of the Hello18's model so that the DNA will print with a right-handed spiral (i.e., as regular DNA, not zDNA).
thingiverse
The Fpg:DNA complex is a potent molecular machine that zeroes in on oxidized guanine and efficiently eliminates it from the scene, rendering its damaging effects null and void.
thingiverse
dna clone https://www.fasttech.com/p/1735400 510 connecteur https://www.fasttech.com/p/1563302 support batterie utiliser que les connecteurshttps://www.fasttech.com/p/1290005 switches https://www.fasttech.com/p/1011700 Instructions un peux...
grabcad
DNA Strand Double Helix models done in solidworks, illustrative purposes only, not scientifically accurate. ...Two different models made using different methods, one shows the nucleotides
thingiverse
Desktop rendering of a double helix DNA model utilizing SolidWorks' three-dimensional design capabilities to craft an intricate, 3D representation of genetic code architecture.
sketchfab
> 1dna pdb human dna single-stranded sequence: 5'ggctagccttaggccgaccgtcgcacggccggcacgccggcacgccaggca 3'gcgcggcacgccggcacgccaggcgcacgccggcacgccggcacgccggc 5'gcgcggcacgccggcacgccaggcgcacgccggcacgccggcacgccggc 3'gcgcggcacgccggcacgccaggca structure:...
thingiverse
... of the Month page. These are great for explaining how the sequencing is performed in an ONT MinIon. Also available here: https://3dprint.nih.gov/discover/3dpx-016224 and here: https://www.printables.com/model/126570-dna-sequencing-nanopore
thingiverse
A DNA clamp, also referred to as a sliding clamp, enhances processivity in DNA replication by encircling double-stranded DNA and serving as a mobile tether for numerous partner proteins like replicative DNA polymerases. In E. coli, it is composed of...
thingiverse
We've been developing our 3D DNA model right here in the lab at school, and once the students finalize their design, we'll post fresh updates on our progress. ...We actually created a scale model that's about half the size of the actual DNA molecule.
prusaprinters
A DNA model where the letters representing the bases of DNA contribute to the pairing. This is a continuation of my attempts to create something to help me remember which bases are which via 3D representations. Category: Interactive Art
cgtrader
This is a fully 3D printed regulated Squonk Mod that runs on a single x 18650 battery and a DNA75 chip.\nTo get it up and running, you'll also need one Keystone 5209 and one Keystone 228; simply clip them to size, but be aware that using two Keystone...
thingiverse
...For more information on accurate DNA structure, visit http://en.wikipedia.org/wiki/Z-DNA#Comparison_Geometries_of_Some_DNA_Forms. OpenSCAD file provides customization options including base and backbone shapes, spacing between strands, and rotation.