evolv dna 200 mod 3d models

94905 3d models found related to evolv dna 200 mod.
DNA Helix 3D model
DNA Helix 3D model
cgtrader

DNA model created in 3dsMax 2021 and render with Vray 5.

DNA Pencil Holder
DNA Pencil Holder
cults3d

I re-modeled the DNA HElix Pencil Holder so you can have different configurations

DNA Helix 3D model
DNA Helix 3D model
cgtrader

DNA model created in 3dsMax 2021 and render with Vray 5.

Right-handed DNA FIXED
Right-handed DNA FIXED
cults3d

This is a simple mirrored remix of the Hello18's model so that the DNA will print with a right-handed spiral (i.e., as regular DNA, not zDNA).

DNA Bottle Opener
DNA Bottle Opener
prusaprinters

Bottle opener with a DNA molecule wrapped around it. ...The DNA molecule is offset to one side so that it can be printed without support. Category: Kitchen & Dining

Desktop DNA - V1
Desktop DNA - V1
grabcad

Medium sized desktop DNA sculpture that is 4" diameter x 6.5" tall. ...This is an update of my poorly done 2015 SketchUp model: https://3dwarehouse.sketchup.com/model/u724d5c6e-22ab-405a-b067-e375a49997b4/DNA-SculptureModel units are inch.

Right-handed DNA
Right-handed DNA
thingiverse

A tweaked mirror replica of the Hello18 model is utilized to ensure that the DNA strand is printed with a standard right-twisted spiral structure - much like conventional double-stranded DNA, but not in the manner of zDNA.

Oxaliplatin bound to DNA
Oxaliplatin bound to DNA
sketchfab

Oxaliplatin forms a tight bond with DNA, twisting its secondary structure into a tangled knot. ...This structural upheaval effectively freezes DNA replication in non-resting cells, like those found in cancerous growths.

3D-paired DNA
3D-paired DNA
prusaprinters

A DNA model where the letters representing the bases of DNA contribute to the pairing. This is a continuation of my attempts to create something to help me remember which bases are which via 3D representations. ... Category: Interactive Art

DNA Silver Ring
DNA Silver Ring
myminifactory

I envisioned crafting an eye-catching ring that bears a striking resemblance to the iconic double helix structure of DNA.

DNA Silver Ring
DNA Silver Ring
myminifactory

I envisioned creating a ring that resembles DNA, a molecular structure that forms the foundation of all life on Earth.

INTERACTIVE DNA MODEL
INTERACTIVE DNA MODEL
thingiverse

Students Explore Dynamic Genetics by Interacting with this Realistic DNA Model Perfect for Classroom Experiments and Learning about Genomics.

Magnetic DNA model
Magnetic DNA model
prusaprinters

Model of DNA bases, used to demonstrate hydrogen bonding by the use of magnets (8x6x4mm cube). Category: Biology

DNA Spiral - Figure
DNA Spiral - Figure
thingiverse

The human DNA helix stands at an impressive 120 millimeters tall and 70 millimeters wide in diameter.

DNA String Art
DNA String Art
prusaprinters

A nice sculpture of DNA Strings, and a nice challenge to print right. ...Enjoy!Show your makes please!

Magnetic DNA model
Magnetic DNA model
thingiverse

DNA Base Model with Magnet Demonstrations, showcasing Hydrogen Bonding through Magnetic Attraction within an 8x6x4 Millimeter Cube.

DNA Puzzle (English version)
DNA Puzzle (English version)
thingiverse

Scientists use puzzle pieces to construct an intricate replica of the DNA's iconic double helix structure.

DNA Helix (no support)
DNA Helix (no support)
cults3d

A precise replica of the twisted DNA molecule, simplified for hassle-free printing without the need for supporting structures.

DNA string 3d model
DNA string 3d model
grabcad

A 3d model of a DNA-string. ...Modeled in 3ds max 2010, rendered with V-ray 1.5.

DNA structure 3D model
DNA structure 3D model
cgtrader

... instructions vital to living organisms' development and functionality. Consisting of genes and other functional segments, DNA serves as a blueprint containing essential information for constructing cell components like proteins and RNA molecules.

3D DNA Model
3D DNA Model
sketchfab

Bring to Life the Fascinating World of Genomics with Animated 3D DNA Models Unlock the Secrets of the Genetic Code with Interactive Visualizations Witness the Intricacies of DNA Unfold Before Your Eyes The Cutting-Edge Technology Behind Animated 3D...

DNA / RNA Manipulatives
DNA / RNA Manipulatives
thingiverse

**NGSS DNA/RNA Manipulative Lesson Plan** This comprehensive lesson plan is designed for middle school to high school students and covers the composition and construction of DNA and RNA, including replication, transcription, and protein synthesis. 2....

DNA Deoxyribo Nucleic Acid
DNA Deoxyribo Nucleic Acid
3docean

DNA serves as a molecule that delivers genetic instructions crucial for the growth, development, functioning and reproduction of every living organism and many viruses known today. DNA and RNA are nucleic acids; together with proteins, lipids and...

DNA SPI double helix
DNA SPI double helix
myminifactory

The DNA molecule encodes the genetic instructions used by all known living organisms and many viruses to develop and function. Its unique structure makes it well-suited for storing biological information, which is replicated as its two strands are...

DNA Better Spin Test
DNA Better Spin Test
sketchfab

> 1dna pdb human dna single-stranded sequence: 5'ggctagccttaggccgaccgtcgcacggccggcacgccggcacgccaggca 3'gcgcggcacgccggcacgccaggcgcacgccggcacgccggcacgccggc 5'gcgcggcacgccggcacgccaggcgcacgccggcacgccggcacgccggc 3'gcgcggcacgccggcacgccaggca structure:...

mark page DNA
mark page DNA
thingiverse

this files is a mark page of DNA. ...It's perfect for students that to learn the biology and do no forgot pages importants!

Bacterial DNA clamp
Bacterial DNA clamp
thingiverse

A DNA clamp, also referred to as a sliding clamp, enhances processivity in DNA replication by encircling double-stranded DNA and serving as a mobile tether for numerous partner proteins like replicative DNA polymerases. In E. coli, it is composed of...

DNA-sequencing nanopore
DNA-sequencing nanopore
thingiverse

Molecular surface representation of a nanopore (PDB ID 6si7) together with the bacteriophage phi29 DNA polymerase (PDB ID 1xhz) and a piece of DNA. The nanopore and polymerase are sliced in half and have locations for magnets, while the DNA is...

DNA Strand Double Helix
DNA Strand Double Helix
grabcad

DNA Strand Double Helix models done in solidworks, illustrative purposes only, not scientifically accurate. ...Two different models made using different methods, one shows the nucleotides

DNA Double Helix
DNA Double Helix
thingiverse

Desktop rendering of a double helix DNA model utilizing SolidWorks' three-dimensional design capabilities to craft an intricate, 3D representation of genetic code architecture.