reloop spin 3d models

Tiny space water container ..sensual and functional.

Hello,\r\n\r\nThis clever spoon lets you mix your yogurts with just a simple up and down motion.\r\nIt consists of four easy-to-print and assemble parts.\r\n\r\nWatch the video below for a...

Human: The human is a complex and fascinating species, characterized by their unique blend of rationality and emotion. They possess a highly developed brain that enables them to think critically and make decisions based on logic and reason. ...At the...

I'm only posting this for fans of Team Fortress 2 who want a sneak peek at my reworked Disguise Kit model. For everyone else, feel free to ignore this post - I'll just be showing off my custom skin on GameBanana. The kit is actually designed to be...

Individuals are a vital part of the ecosystem, playing key roles in maintaining balance and regulating populations within their environments. Through various behaviors such as predation, competition, and symbiosis, humans interact with other species...

I designed an authentic OG Beyblade and took it to the next level by crafting a custom attack ring all on my own, ditching the standard issue design from Kuny808.

A striking vase design with an inverted shape. ...I'm sure it will look great on your flowers.

Humans designed and crafted this to be installed or hung so that the wind could impact it.

This project is a creative reproduction of an original wooden model. A folk wooden toy can be hacked using a 3D printer. Hacking Toys is the name of our project that aims to take a look at popular toys and create a modern version, with digital...

A compact redesign aims to shape it into a sleek cylinder, expanding storage capabilities substantially. ...Turn clockwise to effortlessly unlock it.

The human form is a complex and intriguing subject that has captivated scientists and philosophers alike for centuries. Despite its intricate nature, humans are surprisingly resilient and adaptable beings, able to thrive in an astonishing array of...

No description is available for Human at this time.

Hi everyone, I'm Ship Wheel Fidget Spinner - a compact edition designed specifically for attaching to your keys. You can also find similar designs under "Holding Things," which is another one of my creations. ...To see more, just download and explore!

fins are overrated it's time to spinhonestly probably wouldn't work irl, but i'd love to try it out

This is a detailed outline of the custom bat fidget spinner featuring a 30mm outer diameter bearing.

This customized version of http://www.thingiverse.com/thing:188275 was made using the Customizer! (http://www.thingiverse.com/apps/customizer/run?thing_id=188275). The following options were used in the creation process: Knurl Smoothness = 50;...

A refined and sophisticated container awaits. Craft with precision using Spiralize (Cura), Vase Mode (S3D) or Spiral Vase (Slic3r). ...Its stature is impressive, yet flexible - effortlessly scalable to your heart's desire!

Création d'une tour avec 3 sorties aléatoires ou une seule avec un virage. D'une hauteur de 35 mais j'ai la posibilité de l'agrandir sur demande. Creation of a tower with 3 random exits or only one with a turn. From a height of 35 but I have...

Here's a human-generated PDB file containing the complete sequence of a DNA molecule. ... > 1dna pdb human dna single-stranded sequence: 5'ggctagccttaggccgaccgtcgcacggccggcacgccggcacgccaggca 3'gcgcggcacgccggcacgccaggcgcacgccggcacgccggcacgccggc...

this is still un printed will update as i go

I'm always on the lookout for creative ways to repurpose old materials. Recently, I found myself pondering how to breathe new life into some discarded filament spools. The idea struck me: why not craft a compact table that can be spun by hand using...

Introducing Light by Lasvit - a stunning 3D model from the renowned Design Connected collection, which boasts over 6500 exclusive pieces. This meticulously crafted model is created using 3ds Max and V-Ray renderer. Discover more mid-century icons,...

I'm here to assist. ...What is the original text?

So I've spotted none of these caps with a pointed top so I figured it was time to design my own.

This model is a Christmas prop designed for 12mm bullet pixels. It holds 296 pixels. ...This is a good transition prop for those wanting to have a few High Definition props in your display.

Sports Exercise Bike Spin Bike Eurofit S20

The pack includes 9 distinct Spin Top models and over 27 different components, such as Spin 8, Spin 8.2, Spin 8.3 (2256 polys), Spin 9, Spin 9.2, Spin 9.3 (2390 polys), and Spin 10, Spin 10.2, Spin 10.3 (2290 polys). Textures are available in sizes...